Review



avr ii spe  (InvivoGen)


Bioz Verified Symbol InvivoGen is a verified supplier
Bioz Manufacturer Symbol InvivoGen manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 94

    Structured Review

    InvivoGen avr ii spe
    Avr Ii Spe, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 14 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/avr+ii+spe/pCpGfree-Lucia/pmc04741955-225-36-45
    Average 94 stars, based on 14 article reviews
    avr ii spe - by Bioz Stars, 2026-10
    94/100 stars

    Images

    Related Articles

    Functional Assay:

    Article Title: Decrease of 5hmC in gastric cancers is associated with TET1 silencing due to with DNA methylation and bivalent histone marks at TET1 CpG island 3′-shore
    Article Snippet: GC cells were seeded in 10-cm dishes at a density of 1 × 10 6 cells at 1 day before drug treatment and were then treated with 2 μM 5-Aza-dC (Sigma-Aldrich, Taufkirchen, Germany) every 48 h for 4 days. .. To assess any functional role for CpG sequences of interest, the target sequence (613 bp) was amplified from 69,991,078 to 69,991,690 of human chromosome 10 (hg18) using the primer set described in and inserted into the Avr II/ Spe I sites of the pCpGfree-promoter-Lucia vector (InvivoGen, Toulouse, France), which is a reporter plasmid completely devoid of CpG dinucleotides. .. For in vitro methylation, 10 μg of the reporter constructs was incubated with 32 U Sss I methylase (NEB) and 32 mM S-adenosylmethionine (NEB) at 37°C overnight.

    Sequencing:

    Article Title: Decrease of 5hmC in gastric cancers is associated with TET1 silencing due to with DNA methylation and bivalent histone marks at TET1 CpG island 3′-shore
    Article Snippet: GC cells were seeded in 10-cm dishes at a density of 1 × 10 6 cells at 1 day before drug treatment and were then treated with 2 μM 5-Aza-dC (Sigma-Aldrich, Taufkirchen, Germany) every 48 h for 4 days. .. To assess any functional role for CpG sequences of interest, the target sequence (613 bp) was amplified from 69,991,078 to 69,991,690 of human chromosome 10 (hg18) using the primer set described in and inserted into the Avr II/ Spe I sites of the pCpGfree-promoter-Lucia vector (InvivoGen, Toulouse, France), which is a reporter plasmid completely devoid of CpG dinucleotides. .. For in vitro methylation, 10 μg of the reporter constructs was incubated with 32 U Sss I methylase (NEB) and 32 mM S-adenosylmethionine (NEB) at 37°C overnight.

    Amplification:

    Article Title: Decrease of 5hmC in gastric cancers is associated with TET1 silencing due to with DNA methylation and bivalent histone marks at TET1 CpG island 3′-shore
    Article Snippet: GC cells were seeded in 10-cm dishes at a density of 1 × 10 6 cells at 1 day before drug treatment and were then treated with 2 μM 5-Aza-dC (Sigma-Aldrich, Taufkirchen, Germany) every 48 h for 4 days. .. To assess any functional role for CpG sequences of interest, the target sequence (613 bp) was amplified from 69,991,078 to 69,991,690 of human chromosome 10 (hg18) using the primer set described in and inserted into the Avr II/ Spe I sites of the pCpGfree-promoter-Lucia vector (InvivoGen, Toulouse, France), which is a reporter plasmid completely devoid of CpG dinucleotides. .. For in vitro methylation, 10 μg of the reporter constructs was incubated with 32 U Sss I methylase (NEB) and 32 mM S-adenosylmethionine (NEB) at 37°C overnight.

    Plasmid Preparation:

    Article Title: Decrease of 5hmC in gastric cancers is associated with TET1 silencing due to with DNA methylation and bivalent histone marks at TET1 CpG island 3′-shore
    Article Snippet: GC cells were seeded in 10-cm dishes at a density of 1 × 10 6 cells at 1 day before drug treatment and were then treated with 2 μM 5-Aza-dC (Sigma-Aldrich, Taufkirchen, Germany) every 48 h for 4 days. .. To assess any functional role for CpG sequences of interest, the target sequence (613 bp) was amplified from 69,991,078 to 69,991,690 of human chromosome 10 (hg18) using the primer set described in and inserted into the Avr II/ Spe I sites of the pCpGfree-promoter-Lucia vector (InvivoGen, Toulouse, France), which is a reporter plasmid completely devoid of CpG dinucleotides. .. For in vitro methylation, 10 μg of the reporter constructs was incubated with 32 U Sss I methylase (NEB) and 32 mM S-adenosylmethionine (NEB) at 37°C overnight.



    Similar Products

    94
    InvivoGen avr ii spe
    Avr Ii Spe, supplied by InvivoGen, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/avr+ii+spe/pCpGfree-Lucia/pmc04741955-225-36-45
    Average 94 stars, based on 1 article reviews
    avr ii spe - by Bioz Stars, 2026-10
    94/100 stars
      Buy from Supplier

    90
    Oligos Etc for spe i-3xtev recognition sites- avr ii 5’actagtgagaacctctattttcaa ggcccgcgggagaatttgtatttcca gggtggtagcgagaatttgtattt tcagggtcctagg3

    For Spe I 3xtev Recognition Sites Avr Ii 5’actagtgagaacctctattttcaa Ggcccgcgggagaatttgtatttcca Gggtggtagcgagaatttgtattt Tcagggtcctagg3, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/avr+ii+spe/for+spei+3xtev+recognition+sites/pmc08629431-38-1-0
    Average 90 stars, based on 1 article reviews
    for spe i-3xtev recognition sites- avr ii 5’actagtgagaacctctattttcaa ggcccgcgggagaatttgtatttcca gggtggtagcgagaatttgtattt tcagggtcctagg3 - by Bioz Stars, 2026-10
    90/100 stars
      Buy from Supplier

    Image Search Results


    Journal: Developmental Cell

    Article Title: Loss of sister kinetochore co-orientation and peri-centromeric cohesin protection after meiosis I depends on cleavage of centromeric REC8

    doi: 10.1016/j.devcel.2021.10.017

    Figure Lengend Snippet:

    Article Snippet: Oligos for Spe I-3xTEV recognition sites- Avr II 5’actagtGAGAACCTCTATTTTCAA GGCCCGCGGGAGAATTTGTATTTCCA GGGTGGTAGCGAGAATTTGTATTT TCAGGGTcctagg3’ , , N/A.

    Techniques: Recombinant, Software